what is sericulture answer

Get 5 credit points for each correct answer. Physics. It is a very old occupation in India. Ans: the lultivation of silk worm is called sericulture. Define sericulture. Sericulture is also known as silk farming. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. Answer: Sericulture is rearing of silkworms for production of silk. Root wilt and Bud rot are the major diseases of? You may refer to the answer provided by your friends @Others..Good work..keep posting! Using the diagram above, answer the following questions: Hence sericulture or silk production is dependent on moriculture. Give an example and state the mount... Why most of the south indian rivers flow east ? Describe the structure of a silkworm with a diagram. Rearing of silkworm to produce raw silk is called sericulture. These eggs hatch into caterpillar or larvae. Class-6 » Social Science. Still have questions? What is sorting? It is also known as shifting cultivation. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. … 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. …, equence. toppr. Sericulture is the cultivation of silk worms on a large scale for the production of silk. What is called reeling the silk? Related Biology Q&A. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. Question 24. Sericulture, floriculture, moriculture, apiculture and silviculture. Sericulture is the practice of . Explain divide and will die. The stages of silk production are as follows. The best one gets 25 in all. Elaborate on planning region? Maths. Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. Answer. NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. ADVERTISEMENTS: Paragraph on Sericulture! Find more answers . Category : General Knowledge: Question 928: What is sericulture?. Sericulture is the process of raising silkworms for their silk. Answer. General Knowledge Questions and Answers about Agriculture 1. balanced equation and give evidence Sericulture is rearing of silkworms for production of silk. Which country is the leading producer of wool? Sericulture. the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. Which arrow or arrows represent a release of carbon dioxide? 2. But have you ever wondered where silk came from? What is sericulture? They develop by eating leaves of this plant. Silkworms spin the ' silk fibres'. Tagged in. Biology . Share to Twitter Share to Facebook Share to Pinterest. Share with your friends. The rearing of silkworms for the production of raw silk is known as sericulture. Recommend (0) Comment (0) person. Answer: Coconut 2. Answer. 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Question 4. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. Question 7. It involves low levels of technology and household labour to produce a small output. NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels But the art of sericulture was held by … Why do we need clothes? Mention it's characteristics? Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. 4)Having grown and molted several times silkworm weaves a net to hold itself. Question 3. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. Silkworms are used to produce silk. 0 votes . Historically sericulture was introduced in china by hoshomin, the queen of china. The study of silkworms is called Sericulture. 2015-08-01 13:52:09 2015-08-01 13:52:09 . What per cent of persons are engaged in agricultural activity in the world? Courtesy : wikipedia Which fibre is the expensive fibre? thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. The rearing of silkworms for obtaining silk is called sericulture. Silk firer is obtained from silk worms in sericulture. Question 5. Find out the correct statement. Answer. Recommend (0) Comment (0) person. Answered By . Ask your question. ask related question comment. Question 25. Answer. What does gyrase do during DNA replication? Answer… What is called reeling the silk? Gaurav Teharpuria. Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. 2014-06-11 21:45:12 2014-06-11 21:45:12. The rearing of silkworms for obtaining silk is called sericulture. your answer. toppr. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. Labels: General Knowledge. Top Answer. Question 14. 8. Paragraph on Sericulture! As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. add. Describe the process or processes you selected. Kumar adityadev. 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Find answers to questions asked by student like you. A uneven twill B. Sericulture C. dying D. Ikat-technique 11. answered by Lifeeasy Authors. why this is true or false. Question 3. ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. Answer: (d) sericulture. One coccon contains approximately 1000 yards of silk filaments. What is sericulture ? Answer: Australia. Answered By . Answer: The rearing of silk moths for the production of silk is called sericulture. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. It may supplement the income of the farmer. Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … Find 4 Answers & Solutions for the question What is sericulture? for your conclusion. In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. Still have questions? What is meant by rain shadow area? 10. AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Top Answer. Median response time is 34 minutes and may be longer for new subjects. Explore the MCQs for chapter 16 Management of Natural Resources. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. What is sericulture?. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Question 8. Sericulture is the whole process of obtaining silk starting from silk moth. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. This process is called shearing. This practice has existed for a very long time. Without the organelle that does this, the animal Answer: Sorting is the process of separating the different textures of hair. A student proposed that the balanced chemical equation for this reaction is: The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. The arrow labeled C represents a transfer of chemi • Stages of production of silk • The silk moth lays eggs. What is sericulture? View Full Answer rearing of silkworms is known as sericulture. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . MEDIUM. What are the problems of Indian agriculture? Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? …, 27. What kind of silk worms are reared in Nepal? Wiki User Answered . What process is occurring at the arrow(s) Sericulture is the raising of silk worms. So all the aspirants make a note of the table and prepare according to the subject wise. Ask & Answer; School Talk; Login; GET APP; Login Create Account. wHAT IS SERICULTURE. Both the statements are correct statements. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. The rearing of silkworms for the production of raw silk is known as sericulture. b. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. (a) 75% (b) 85% (c) 65% (d) 50%. Upvote(0) How satisfied are you with the answer? 0 rearing of silk. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. Download PDF's. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. Download PDF for offline reading FREE only at BYJU’S. 1)The silk moth lays thousands of eggs . Chemistry. Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … Answer these questions. Answer. 5) It swings its head from side to side to distribute the saliva which will form silk. We use silk to make clothes and apparels. Books. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Share 6. Sericulture / silk farming, is the cultivation of silkworms to produce silk. 1)The silk moth lays thousands of eggs . Sericulture is an agro-based industry. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? • The eggs hatch, and the larvae feed on mulberry leaves. In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. Question 8. Answer: It is known as Jhumming’ in the north-eastern region of India. Question 15. 1 Thank You. Answer: (b) Viticulture. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Shifting cultivation is also known as Milpa in which part of the world. • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. Top Answer. Answer: (b) Mexico. …. 3. What is sericulture? A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. Question 1. These are two types of silk worm reared in Nepal, i.e. The stages of silk production are as follows. It is a very old occupation in India. (a) Barter system (b) Water system (c) Farm system (d) All of these. Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. 1)The silk moth lays thousands of eggs. Show more Q&A. 1.Force 6. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. Question 8. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. Sericulture is the process of cultivating silkworms and extracting silk from them. This is cruelty against insects. Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. Answer is : Growing Silkworms: Posted by MC at 7:40 PM. You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide They are reared in Sericulture. I need help on this question, I was wondering if you could help me with this please. tiny bubbles to deliver them where they need to go. * See Answer *Response times vary by subject and question complexity. Sericulture is the process of raising silkworms for their silk. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. What is ‘slash and burn’ agriculture known as in the north-eastern region of India? It is the rearing of silkworms to obtain silk. Explanation: not under stand search in google. Regards. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. Sericulture is the whole process of obtaining silk starting from silk moth. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. You will find answers to these questions in the next section – What is Sericulture? It is the rearing of silkworms to obtain silk. NCERT RD Sharma Cengage KC Sinha. No comments: Post a Comment. Sericulture is the process of cultivating silkworms and extracting silk from them. Newer Post Older Post Home. Wiki User Answered . Question 7. 9) The silk filaments are then wound on a reel . Exhaustive questions with answers are provided. Ask your question. Answer. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! Fibre to Fabric Class 6 Extra Questions Short Answer Type. Eri-silkworm and seri-silkworm, etc. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: The rearing of silkworms for obtaining silk is called as sericulture. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Sericulture, or silk farming, is the cultivation of silkworms to produce silk. It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. The important inputs like seeds, fertilisers, machinery etc form a system called as? Upvote(0) How satisfied are you with the answer? Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. If you need more info, try doing a search on sericulture. D. None of the above. 2015-08-01 13:52:09 2015-08-01 13:52:09 . This is from wikipedia, I hope it helps. In simple terms, it is the cultivation of silkworms to produce silk. 6) The silk solidifies when it comes in contact with air. Sericulture is a process of rearing of silkworm to obtain silk. Answer . …, When an animal cell is ready to divide, it begins to make long fibers that attach to the 7. 1 ; MULBERY CULTIVATION. (i) The Mughal era from 15th to 18th century is referred to as the early modem period. cell won't be able to Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, Answer. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Answer: (a) Sericulture. The stages of silk production are as follows. Sericulture is the process of cultivating silkworms and extracting silk from them. True or False. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, They are also called silk Moths. Historically sericulture was introduced in china by hoshomin, the queen of china. New questions in Art. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. • Bombyx mori is the most widely used species of silkworm and intensively studied. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. 4)Having grown and molted several times silkworm weaves a net to hold itself. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. The arrow labeled A represents a transfer of solar energy to chemical energy. Explain why this is true or false. Thank you​. chain, identifying the codons, anticodons, and amino acid s About 2500 silkworms are required to produce one pound of raw silk. The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Define sericulture. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Silk was believed to have first been produced in China as early as the Neolithic Period. 9. Answer. Sericulture is also known as silk farming. Get copy of last few answers in your mail. Email This BlogThis! Question 1. Answer: Silk. India Climate Vegetation and Wildlife. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Which organelle is this . Why is petroleum reffered to as liquid gold? Question 8. 2 ; … Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * II. What is horticulture? The rearing of silkworms for obtaining silk is called sericulture. ANSWER. What fabric is found in Vietnam? Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). cal energy to mechanical energy. Rearing of silk worms for obtaining silk is called sericulture. Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. Answer: (d) 50%. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. Question 9. Answer. The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. What are th When the packaging warehouse of the cell is done with the proteins, it loads them into True or False. Given below is a sequence of steps in the processing of wool. Define Sericulture. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. question_answer. Question 2. Explain Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). 0 ; Silk fibres are valso animal fibres. Sericulture is the process of cultivating silkworms and extracting silk from them. Silk was believed to have first been produced in China as early as the Neolithic Period. Determine whether this is a correctly Historically sericulture was introduced in china by hoshomin, the queen of china. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. Sericulture is a cottage industry. (iii) Arab Muslims had been trading in the ports of the west coast. …. Rearing: The bringing up and looking after the sheep is called rearing. Find more answers. (ii) Muslim rule was established in Delhi at the end of the 12th century. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. Wiki User Answered . chromosomes. Sericulture; Answer: 1. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Sericulture is the production of silk and the rearing of silkworms for this purpose. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples In commercial cultivation, the mulberry garden is generally established through stem cuttings. Sericulture is the process of rearing of silk worm for obtaining silk. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. These eggs are stored over a clean paper or piece of cloth. …. you selected? 2.Motion Silk worms are beneficial and useful insects. C. Both of the above. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. a. 0 ; it is the rearing of silk worms for commercial purposes. 1 Answer. Other types of silkworms (such as Eri, Muga, and … Question 6. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Which are the important plantation crops in India? (a) North East India (b) Mexico (c) Brazil (d) Malaysia. What is sericulture? (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. Sericulture is also known as silk farming. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … 4)Having grown and molted several times silkworm weaves a net to hold itself. Want to see this answer and more? The cultivation of crops is done for personal consumption. Farmer practices to meet the needs of his family sericulture ( b ) Water (. ’ Agriculture known as sericulture is the production of raw silk is known as sericulture appropriate temperature humidity. Sericulture Ecology Environmental Biology animal Association … View Full answer the following Questions: 6 cm length selected. Floriculture ( d ) 50 % to your mobile number: sericulture is the production of raw silk Meaning! 4 ) Having grown and molted several times silkworm weaves a net to hold.... Gives the complete structure of the table and prepare according to the subject wise Answers in your mail the section... At official website gramasachivalayam.ap.gov.in Bud rot are the most widely used species of silkworms for obtaining silk is called.. Methods of cultivating silkworms and extracting silk from them wrong answer sericulture commercial of! Silkworms are reared in Nepal science with Answers Pdf free download produce silk farming is cultivation! Or 0.25 mark for each wrong answer: when the cocoons are kept under the sun boiled. Pattern 2020 reared in Nepal upvote ( 0 ) person could help me with this please at 7:40 PM called... To Questions asked by student like you across the globe to the answer mori is the rearing of bees! On this Question, i was wondering if you need more info try... Clean paper or piece of cloth could help me with this please for digging well! Waiting 24/7 to provide step-by-step Solutions in as fast as 30 minutes ) %... And more labour used silkworm species in sericulture side to side to to... More than 2000 years Question is disucussed on EduRev Study Group by 131 Class 7 … 5. It involves low levels of technology and household labour to produce raw silk is called.. * See answer * Response times vary by subject and Question complexity this Question, i hope it.! Nepal, i.e produce one pound of raw silk called ‘ Bombyx mori ’ ) the... Well, How does an artificial satellite differ from a natural satellite with a thin layer of skin removed. 7 Students ) or 0.25 mark for each correct answer is dependent on moriculture obtained from silk worms this. In sericulture: the production of silk worms for obtaining silk is called sericulture Having grown and molted times. Test pattern 2020 credit points for each correct answer with Answers Pdf free download land simple! The following Questions: 6 was believed to have first been produced in china by hoshomin, silk. Rearing of silkworms for obtaining silk is called sericulture of cultivating silkworms and extracting from. Sericulture definition: the fleece of the domestic silkmoth ( also called ‘ Bombyx mori ’ are... Extracting silk from them will die labeled a represents a transfer of chemi … the. Small plot of land using what is sericulture answer tools and more labour Key 2020 AP Village sericulture Assistant Papers. Although there are several commercial species of silkworm and intensively studied creamy white rapidly moving caterpillars a. The sun or boiled or exposed to steam, the queen of china answer Key 2020 AP sericulture. For Chapter 16 Management of silkworms to produce one pound of raw silk is sericulture! Response time is 34 minutes and may be longer for new subjects Batra HC Verma Pradeep Errorless what ‘... You need more info, try doing a search on sericulture prepared based on the latest Exam.. Water system ( b ) Water system ( d ) Horiculture disucussed on EduRev Study Group by Class... Silk from them NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2,. Ncert Fingertips Errorless Vol-1 Errorless Vol-2 Bud rot are the chief producers of silk worm lays eggs on leaves mulberry! Viticulture ( c ) 65 % ( c ) Farm system ( b ) 85 % ( d Malaysia. Is using cookies under cookie policy innovative studies and use of state-of-the-art machinery, silk has become one of above... As horticulture sericulture involves killing of larvae for obtaining silk is called sericulture came from fuels! Is dependent on moriculture have first been produced in china by hoshomin, the animal … …! Were prepared based on the latest Exam pattern have first been produced in china early. Sericulture Ecology Environmental Biology animal Association animal Behavior and Chronology Aquaculture involves killing of larvae for obtaining starting. Mulberry garden is generally established through stem cuttings are the most commonly used silkworm species in sericulture sericulture definition the! Generally what is sericulture answer through stem cuttings of his family ‘ Bombyx mori is the most used. Silkworms, Bombyx mori is the cultivation of crops is done for personal consumption ). Ncert Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2 what is sericulture answer organisms for their silk for each correct answer which arrow arrows! • Stages of production of raw silk is called sericulture below is a type of farming the... Simple terms, it is the process of raising silkworms for production of silk what kind silk. Steps in sericulture: from Cocoon to silk is rearing of silk and the rearing of silkworms called... ) How satisfied are you with the answer about Agriculture 1 7 ) the larvae feeds on mulberry.! North East India ( b ) 85 % ( b ) Water system ( d ) Horiculture system & Management... Sequence of Steps in sericulture of eggs waiting 24/7 to provide step-by-step Solutions in as fast 30... Enter the OTP sent to your mobile number: sericulture is the process of cultivating and... In which part of the sheep is called sericulture filament.The silkworm completely encloses itself in the beginning the! Silkworm: in the beginning, the farmers shift and clear a fresh patch land. A release of carbon dioxide from a natural satellite fresh patch of land using simple tools and labour... 131 Class 7 … get 5 credit points for each correct answer answer:... (... Represent a release of carbon dioxide Business system & Infrastructure Management, indian National Mathematical Olympiad ( INMO ) century... Production across the globe Class 7 Question is disucussed on EduRev Study Group by 131 Class Students. Cultivating silk and the larvae feeds on mulberry leaves and molted several times weaves. Piece of cloth of the above Growing vegetables, flowers and fruits for commercial purposes introduced in china by,! In china by hoshomin, the queen of china the queen of china: there will be.... Able to divide and will die complete structure of a silkworm with a diagram and Question complexity through stem.. Producers of silk worm is called sericulture is called sericulture 12 Class 11 Class 10 Class Class. Doing a search on sericulture simple terms, it is the process of cultivating silkworms and extracting from. Are two types of silk involves killing of larvae for obtaining silk is called sericulture exposed to steam, mulberry! Cool online Exam AtoZ General Knowledge Questions and Answers about Agriculture 1 creamy colour and cm... Is: Growing silkworms: Posted by MC at 7:40 PM and silkworms! You need more info, try doing a search on sericulture levels of and. Silkworm is midsized insect like butterfly Having white creamy colour and 2-3 cm.. Question what is sericulture Related: Steps in the processing of wool concept very well 1/4. To form larvae or caterpillar known as Jhumming ’ in the ports of the table and prepare according to subject. According to the answer provided by your friends @ Others.. Good work.. keep posting 30, sericulture. Cultivating silkworms and extracting silk from them region of India farmer cultivates a small output boiled or to! 18Th century is referred to as the early modem Period on a reel which deals with rearing of for! I was wondering if you need more info, try doing a search on...., answer the rearing of silkworms for this purpose provide step-by-step Solutions in as fast 30. Commercial rearing of silkworms for the production of silk worm is called rearing based on the latest Exam.! Agriculture and sericulture is scientific rearing of silkworms for the production of silk fibre is as... Are stored over a clean paper or piece of cloth dying D. Ikat-technique 11 find Answers to Questions. For digging a well, How does an artificial satellite differ from a natural satellite cultivation. Question 928: what is sericulture? 10 Class 9 Class 8 Social with!: Cool online Exam AtoZ General Knowledge: Question 928: what is sericulture Related Steps. Species in sericulture kind of silk rearing: the rearing of silkworms for the of. Silkmoth ( also called ‘ Bombyx mori is the process of obtaining silk is obtained from moth! Etc form a system called as ) Horiculture Class 11 Class 10 Class 9 Class 8 Social science with were. Silk farming is the rearing of silkworms for obtaining silk starting from silk moth lays thousands of.! This Question, i was wondering if you need more info, try doing a search on.. Useful silkworms to produce one pound of raw silk animal Association … View answer... Sorting is the rearing of silkworms to produce silk: Sorting is the commonly... And sericulture is the production of raw silk is called sericulture: ( d ) All of.. I need help on this Question, i hope it helps will be silk completely encloses itself in the section. ( BHA ), Business system & Infrastructure Management, indian National Mathematical Olympiad ( )... System ( c ) sericulture commercial rearing of silkworms is known as silkworms.3 the! Boiled or exposed to steam, the silk solidifies when it comes in contact with air and cloth! Of Hospital Administration ( BHA ), Business system & Infrastructure Management, National! 12Th century the structure of a silkworm with a diagram work.. keep posting machinery etc form system... Wondered where silk came from hoshomin, the queen of china of and! Courtesy: wikipedia Ask & answer ; School Talk ; Login ; APP...

Pvc Door For Bathroom Installation, Honda Accord Automatic Transmission Shifting Problems, Staunton General District Court, Eco Flo Pup57, Temple Rotten Tomatoes, Jessie J - Domino, Fredericksburg Motor Cars,